Siebel Results on Wild Yeast 1

To make sure that I was going down the right path, and to get some insight into what methods Siebel was using in the genetic identification of yeasts, I sent off Wild Yeast 1 on a little agar plate to their lab in Montreal. Looking at the report, it seems they actually outsource their labwork somewhere else, potentially Lallemand.

The results came in a few days ago, and it confirms what I found earlier, “WY1″ is 100% Saccharomyces cerevisiae.  

The method applied was sequencing of the domain D1-D2 of the 26s rDNA, as published by Kurtzman CP and Robnett CJ (see FEMS Yeast Res. 2003 Jun;3(4):417-32.) The sequence was then “blasted” agains the NCBI sequence database (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Very similar to what I did before, although my focus was on the ITS. The sequencing and PCR of these domains is a real pain because of the repeats. I have only been partially successful in getting good reads focusing on these sequences. rDNA is notorious as well for this, but I have never tried this specific part of the DNA. Worth a shot.

Below the sequence as received from Siebel:

TTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTA ATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTG AGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAAT GCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGT ACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGG AAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCA CTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTAT AGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAA

A read of 573 nucleotides. A quick Blast indeed revealed 100% S. cerevisiae. Looking at the Genbank sequence it aligns to (GenBank: JQ968601.1)  the two primers used to PCR the 26S rDNA are NL1 and NL4 (See O’Donnell, K. 1993. Fusarium and its near relatives, p. 225-233. in The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics). A quick search in pubmed resulted in this paper by Joseph Cano and coworkers: Molecular and Morphological Identification of Colletotrichum Species of Clinical Interest, J. Clin. Microbiol. June 2004 vol. 42 no. 6 2450-2454 ) Where they list the primer sequences, and the complete protocol for sequencing and PCR.

So, with this information in hand it should be easy to do genetic profiling in the future. 

 

Share on FacebookShare on Twitter

2 thoughts on “Siebel Results on Wild Yeast 1

  1. Awesome post and nice results. Judging from the pics it definitely looks like Sacch.

    However, this is a wild Sacch cerv. strain correct? How did you isolate it? I couldn’t a post about this.

    It would be interesting to note the nucleotide homology – 100%? If that’s the case then its probably not wild. I would expect some polymorphisms to creep up.

    Great that you can do this tho – I can do this easily in the lab now, but spending lab funds for strain ID would be a tad bit unethical…

    Keep us posted on other strains you test!

    Jason

  2. Hi Jason, thanks for your comment! The blog is kind of dead right now, so I am glad its still being read.

    I isolated the strain by putting some media outside and letting it ferment and streaking the media, picking colonies, etc. I think the post on isolation might be before a total blog meltdown, so it might be lost.

    Regarding the polymorphisms, note that we are talking ribosomal DNA, that is the slowest evolving part of the DNA – and extremely conserved (the sequence Siebel used for identification).

    That is why I tried the ITS sequences earlier, the repeats in between the large and small ribosomal subunit. There is not real stress for conservation there, and those sequences diverge very fast compared to rDNA. Unfortunately, those are hard to sequence due to repeats etc. But, I remember looking at the sequence and it was definitely not 100% – more like 80-90%. I have the data not at hand at the moment.

    To come to your statement regarding “wild” or not – all the S. cerevisiae strains coming up on http://www.yeastgenome.org/cgi-bin/blast-fungal.pl (the fungal specific blast server) are 100% identical. Paradoxus, bayanus, uvarum, etc etc. are slightly different, but we are talking about ~5 nucleotides in some cases. So there is very little divergence here (I am actually surprised Siebel uses this sequence, seems pretty inaccurate? We are talking about less than 5% divergence..).

    So definitely S.cerevisiae. Its definitely not a strain I brew with normally, the strain flocs really slow, and produces very little fusels at higher temps.

    And I did not really spend that many resources because this came out of my own pocket :) but one reaction more in a hundred should not be a problem really.

    I will keep posting on more identifications I am performing. I am fermenting some more beer with 5 or so strains. Hopefully those will be done in a month or so.

Leave a Reply

Your email address will not be published. Required fields are marked *

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>